Do you know Matt’s source?
Posted in Uncategorized on 02/22/2009 11:06 am by rachelSo I’ve been researching Jim Malham in the library while freaking out about seeing that girl nearly abducted. If you were Matt’s source - if you’re that girl - or if even if you just know her - please please get in touch. Please know that we didn’t set you up and I’m so sorry if we somehow put you in danger.
Help me find out what happened to my Uncle.
February 22nd, 2009 at 11:41 am
Hey I just found some interesting info about Jim Malham… He works in security, with some big biotech clients, apparently. Also, he has uploaded photos taken in Peru on 21st and 27th Jan. You should definitely try and find out more about this guy.
Kxx
February 22nd, 2009 at 12:43 pm
Is jim m against, with us or someone markus had in his notes?
February 22nd, 2009 at 7:42 pm
Aalia Nazim
This is the name of Matt’s source that he found in the notebook.
February 22nd, 2009 at 8:20 pm
The sources for what Kirsty said…
http://www.linkedin.com/pub/dir/jim/malham :
“Familiar with South American customs and culture. Clients include leading biotech firms.”
Also links to his photos website:
http://picasaweb.google.com/mylomalham
Looks like he’s pretty committed to his photography.
There’s a Jim Malham on Facebook, too, but I think he might be a different person. He’s listed as being in Denmark.
February 23rd, 2009 at 4:27 pm
Rachel,
I’ve had a look at the photos of Aalia’s Notebook that you uploaded.
If she’s okay, she might still go to the Katherine Ryan gig on the 7th at Hoxton Hall as that was already in her notebook.
At least you have an idea of what she looks like - if you and Matt go to the gig, you’ll be able to see if she’s there.
Where are the pages for the 23rd Feb-3rd March? Are they missing? If not, did Aalia have anything written in for those dates? If it was anything like “Ring Mum & Dad”, they might be worried. If she doesn’t ring, they might file a missing person’s report for her.
Hope you’re okay.
Zoe.
xo
February 23rd, 2009 at 8:00 pm
Thanks Thomas - I was in a rush when I left that message
I have also been looking at what Markus had written in his notebook. I looked into the number 1789023 and it is the code for a DNA binding protein in E.coli. It prevents digestion by certain restriction enzymes, and appears to be involved in protein folding. Anyway, I am trying to find out whether this has been linked to any diseases in humans, as perhaps this was the disease Markus was looking to do a trial on… All speculation at the moment. But please look at the ncbi entry and see if you can find anything I’ve missed!
Also, I checked out the Planta Dos Deuses website at http://www.plantadosdeuses.org - some interestng stuff there, for sure. I thought it was quite religious at first, but now I am not so sure. I have e-mailed them for more info. I was intrigued as to why someone like Markus would be interested in a creationist website, well that was what it seemed at first…
Anyway, I’ll keep looking into this. Just wanted to let everyone know where I was up to!
And I am struggling with the spanish - can anyone translate those pages?
K
February 24th, 2009 at 6:45 pm
Kirsty -
The headline on the home page is “Cacto de los cuarto vientos”. This translates to “Cactus of the Four Winds”.
Thank goodness for Spanish dictionaries eh?
xo
February 24th, 2009 at 7:11 pm
Sorry for the double post guys.
If you search “Cactus of the Four Winds” (I’ll refer to it as COTFW from now on), it brings up this page:
http://www.ayahuasca-shamanism.co.uk/Huachuma-SanPedro.htm
The COTFW is a Cactus that is native to Peru. It is said to be lucky for those who find it. They say the plant also has “special healing powers”.
Also, if you go to the home page of the website, it’s all about tours to Peru. Perhaps Markus was one one of them?
The only thing is…if he was, where are the other 9 people who went with him?
Hope this helps - it’s a couple of things to think about anyway!
xo
February 25th, 2009 at 12:12 pm
Kirsty, I’ve also seen that protein, but I suspect it could be a co-incidence. Putting almost any number into that database gets you some protein, that one seems unremarkable, E. coli isn’t a major target for drug research as far as I know, and the note that the number is part of doesn’t seem to fit with a protein. Could it be something like a Peruvian telephone number?
Following a link from the Planta dos Deuses website, there is a site about sending messages in flower code. I wonder if this could be related to the second DNA sequence, that we haven’t deciphered yet? The flowers only seem to represent emotions, though, and there’s not a neat one per letter of the alphabet.
The COTFW appears to be this plant:
http://en.wikipedia.org/wiki/San_Pedro_cactus
“long history of being used in Andean traditional medicine”
“inhibitory action against at least 18 strains of penicillin resistant Staphylococcus bacteria.”"
This would fit in very neatly with the whole story of drug research and allegations of biopiracy–it’s a traditional medicine that has now been studied scientifically. There are also restrictions on it in other countries because of its potential use in recreational drugs.
February 25th, 2009 at 12:23 pm
Have tried translating the DNA sequences found in the frontpage image on Planta dos Deuses website (it seems to be the same sequence, gcttaccatacaggatctaacttcggtaa, in each of the 8 bands). If it means anything, it doesn’t seem to be in plaintext: AYHTGSNFG (see http://www.expasy.ch/tools/dna.html to work out the other 5 possible reads)
February 25th, 2009 at 3:46 pm
Zoe, Thomas, Kirsty - brilliant stuff. Thank you. xx
February 26th, 2009 at 12:57 am
I can’t help but feel that there’s still something to understand in the Planta dos Deuses website. The front page refers to “We must…learn how to read the messages… in the plants and trees”
February 26th, 2009 at 1:07 pm
Hey Thomas, I’d totally be with you if the Planta lot didn’t seem like such a bunch of loons! I just don’t believe Markus would have had anything to do with them - he wasn’t a fan of flaky “science”, to say the least. He might well have known about them / checked out their website in an idle moment, but I doubt he’d have much time for them.